# DNA Sequence Analysis - Transcription, Translation & Splicing

## Overview

This project demonstrates fundamental bioinformatics operations using Python. The program performs DNA sequence manipulation, nucleotide substitution, transcription from DNA to RNA, translation of RNA into amino acids, AT content calculation, and DNA splicing by separating coding regions (exons) from non-coding regions (introns).

## Features

- Perform DNA nucleotide substitution
- Generate modified DNA sequences
- Convert DNA sequence into RNA sequence
- Translate RNA codons into amino acid sequences
- Calculate nucleotide frequency
- Calculate AT content percentage
- Identify exon and intron regions
- Perform DNA splicing by removing introns

## Technologies Used

- Python 3
- Bioinformatics Algorithms
- DNA Sequence Processing
- String Manipulation

## Bioinformatics Concepts Covered

### 1. DNA Mutation / Nucleotide Replacement

The program performs nucleotide changes using temporary replacement characters to avoid replacement conflicts.

Mutation rules:

A → G G → A T → C C → T

Example:

Original DNA:

ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT

Modified DNA sequence is generated by replacing nucleotides according to the given mutation rules.

---

## 2. DNA to RNA Transcription

The complementary DNA sequence is converted into RNA by replacing:

T → U

Example:

DNA:

ACTG

RNA:

UGAC

The generated RNA sequence is used for translation.

---

## 3. RNA Translation

The RNA sequence is translated into an amino acid sequence using the standard codon table.

Each group of three RNA nucleotides represents one codon.

Example:

AUG → M (Methionine) UUU → F (Phenylalanine) UGG → W (Tryptophan)

The translation process stops when a stop codon is detected:

UAA UAG UGA

---

## 4. AT Content Calculation

The program calculates the percentage of Adenine (A) and Thymine (T) bases in the DNA sequence.

Formula:

AT Content = ((Number of A + Number of T) / Total DNA Length) × 100

The program also calculates the frequency of:

- Adenine (A)
- Thymine (T)
- Cytosine (C)
- Guanine (G)

---

## 5. DNA Splicing

DNA sequences contain:

- Exons: Coding regions
- Introns: Non-coding regions

This project performs splicing by removing the intron sequence and combining the exon regions.

Example:

DNA Sequence

Exon 1 + Intron + Exon 2

After Splicing:

Exon 1 + Exon 2

The program extracts:

```python
exon1 = DNA3[:63]
exon2 = DNA3[91:]
intron = DNA3[63:91]

The final coding DNA sequence is created by joining both exons.

Splicing = exon1 + exon2

---

Input Data

The project uses DNA sequences as input for performing different bioinformatics operations.

Example DNA sequence:

ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT

---

Output

The program generates:

• Modified DNA sequence
• RNA sequence
• Amino acid sequence
• Count of A, T, C, and G nucleotides
• AT content percentage
• Exon sequences
• Intron sequence
• Spliced DNA sequence

---

How to Run

1. Clone the repository:

git clone https://github.com/FathimaNufla2000/DNA-Sequence-Analysis-Transcription-Translation-Splicing.git

2. Navigate into the project directory:

cd DNA-Sequence-Analysis-Transcription-Translation-Splicing

3. Run the Python file:

python DNA_Sequence_Analysis.py

---

Learning Outcomes

Through this project, the following bioinformatics and programming concepts are demonstrated:

• DNA sequence processing
• Mutation analysis
• Transcription mechanism
• Translation mechanism
• Codon mapping
• Nucleotide frequency calculation
• Exon and intron identification
• DNA splicing techniques
• Python string manipulation

---

Author

Fathima Nufla

GitHub: https://github.com/FathimaNufla2000

---

License

This project is developed for educational purposes and bioinformatics learning.