@@ -8,15 +8,17 @@ This file contains all notable changes to Bambu-Pipe.
 
 ### Changed
 - Increased the minimum adapter overlap in the `PREPROCESS_FASTQ` adapter re-search from the cutadapt default (3 bp) to 10 bp, reducing the number of valid reads discarded due to short chance matches at read ends
-- Shortened the polyT right flank for 3' and Visium chemistries (`flank_seq_config.csv`) from 30 T to 9 T, matching the flexiplex presets; ONT reads rarely call the full 30 T homopolymer, so few reads matched the flank during barcode discovery
+- Shortened the polyT right flank for 3' and Visium chemistries (`flexiplex_config.csv`) from 30 T to 9 T, matching the flexiplex presets; ONT reads rarely call the full 30 T homopolymer, so few reads matched the flank during barcode discovery
 - Visium samples (`visium-v*`) are now demultiplexed directly against the spot whitelist, as recommended by flexiplex; barcode discovery and flexiplex-filter are skipped, replacing the `-u 0` knee detection workaround
 - Updated the supported chemistry names in the README to the official 10x Genomics assay names, with a link to the 10x Genomics long-read compatibility article
+- flexiplex flank (`-f`) and barcode (`-e`) edit distances are now set per chemistry in `flexiplex_config.csv` (`flank_max_edit_distance`, `barcode_max_edit_distance`), using the flexiplex preset defaults (`-f 8`, `-e 2`); this replaces the `flexiplex_f_5prime`, `flexiplex_f_3prime` and `flexiplex_e` developer parameters. The previous `-f 13` for 3' and Visium chemistries allowed too many errors for the shortened 9 T flank, causing spurious flank matches that slowed `PREPROCESS_FASTQ` considerably
+- Moved the 10x config files out of `assets/10x_config/` into `assets/`, and renamed `adapter_seq_config.csv` to `cutadapt_config.csv` and `flank_seq_config.csv` to `flexiplex_config.csv`
 
 ### Removed
 - `visium-v4` and `visium-v5` (Visium CytAssist Spatial Gene Expression) chemistries, as these probe-based assays do not produce full-length transcripts
 
 ### Fixed
-- Corrected the 10x3v3 and 10x3v4 end adapter (`rev_primer_f`/`rev_primer_r` in `adapter_seq_config.csv`) to `CCCATGTACTCTGCGTTGATACCACTGCTT`, matching 10x3v2 and Visium; the previous sequence does not occur in these reads, so the adapter was rarely trimmed
+- Corrected the 10x3v3 and 10x3v4 end adapter (`rev_primer_f`/`rev_primer_r` in `cutadapt_config.csv`) to `CCCATGTACTCTGCGTTGATACCACTGCTT`, matching 10x3v2 and Visium; the previous sequence does not occur in these reads, so the adapter was rarely trimmed
 - Resolved an edge case where `PREPROCESS_FASTQ` failed if the input FASTQ filename had the same length as the barcode (16) or UMI (10/12) pattern; the unquoted `?` wildcards in the flexiplex pattern were expanded by the shell to match the filename, which was not intended
 
 ## [v0.10.2] - 2026-09-23
 
@@ -1,9 +1,9 @@
-technology,left_flank,barcode,umi,right_flank
-10x3v2,CTACACGACGCTCTTCCGATCT,????????????????,??????????,TTTTTTTTT
-10x3v3,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTTTTTTT
-10x3v4,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTTTTTTT
-10x5v2,CTACACGACGCTCTTCCGATCT,????????????????,??????????,TTTCTTATATGGG
-10x5v3,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTCTTATATGGG
-visium-v1,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTTTTTTT
-visium-v2,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTTTTTTT
-visium-v3,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTTTTTTT
+technology,left_flank,barcode,umi,right_flank,flank_max_edit_distance,barcode_max_edit_distance
+10x3v2,CTACACGACGCTCTTCCGATCT,????????????????,??????????,TTTTTTTTT,8,2
+10x3v3,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTTTTTTT,8,2
+10x3v4,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTTTTTTT,8,2
+10x5v2,CTACACGACGCTCTTCCGATCT,????????????????,??????????,TTTCTTATATGGG,8,2
+10x5v3,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTCTTATATGGG,8,2
+visium-v1,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTTTTTTT,8,2
+visium-v2,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTTTTTTT,8,2
+visium-v3,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTTTTTTT,8,2
@@ -6,9 +6,6 @@ params {
     valid_quantification_modes  = ['no_quant', 'EM', 'clusteredEM']
     save_intermediates          = false
     qfilter_threshold           = 10
-    flexiplex_f_5prime          = 8
-    flexiplex_f_3prime          = 13
-    flexiplex_e                 = 1
     process_by_chromosome       = true
     seurat_dim_single           = 15
     seurat_dim_multi            = 30
 
@@ -65,9 +65,9 @@ workflow STANDARD {
         def ndrArg = ndr != null ? ndr : 'NULL'
 
         // load config files
-        ch_barcode_coordinate_config = file("${projectDir}/assets/10x_config/barcode_coordinate_config.csv", checkIfExists: true)
-        ch_adapter_seq_config = file("${projectDir}/assets/10x_config/adapter_seq_config.csv", checkIfExists: true)
-        ch_flank_seq_config = file("${projectDir}/assets/10x_config/flank_seq_config.csv", checkIfExists: true)
+        ch_barcode_coordinate_config = file("${projectDir}/assets/barcode_coordinate_config.csv", checkIfExists: true)
+        ch_cutadapt_config = file("${projectDir}/assets/cutadapt_config.csv", checkIfExists: true)
+        ch_flexiplex_config = file("${projectDir}/assets/flexiplex_config.csv", checkIfExists: true)
 
         ch_n_samples = ch_rows.count()
 
@@ -79,7 +79,7 @@ workflow STANDARD {
 
         // process fastq samples
         ch_preprocess_fastq_in = ch_input_fastq.map { sample, path, meta -> [sample, path, meta, meta.barcode] } // add whitelist path to fastq input tuple
-        PREPROCESS_FASTQ(ch_preprocess_fastq_in, ch_flank_seq_config, ch_adapter_seq_config)
+        PREPROCESS_FASTQ(ch_preprocess_fastq_in, ch_flexiplex_config, ch_cutadapt_config)
         ALIGNMENT(PREPROCESS_FASTQ.out.fastq, ch_genome, ch_annotation)
 
         if (!params.bam_only) {
 
@@ -11,8 +11,8 @@ process PREPROCESS_FASTQ {
 
     input:
     tuple val(sample), path(fastq), val(meta), path(whitelist)
-    path(flank_seq_config)
-    path(adapter_seq_config)
+    path(flexiplex_config)
+    path(cutadapt_config)
 
     output:
     tuple val(sample), path("${sample}_preprocessed_reads.fastq.gz"), val(meta), emit: fastq
@@ -55,16 +55,10 @@ process PREPROCESS_FASTQ {
     }
 
     # Demultiplexing with flexiplex
-    # Arguments: 1=barcode list file generated by flexiplex-filter
+    # Arguments: 1=barcode list file (flexiplex-filter output, or the whitelist for visium chemistries)
     flexiplex_demux() {
         local barcode_list=\$1
-        if [[ $meta.chemistry == 10x5* ]]; then
-            flexiplex_f=$params.flexiplex_f_5prime
-        else
-            flexiplex_f=$params.flexiplex_f_3prime
-        fi
-
-        flexiplex -p $task.cpus -k \$barcode_list "\${flank_seq[@]}" -f \$flexiplex_f -e $params.flexiplex_e
+        flexiplex -p $task.cpus -k \$barcode_list "\${flank_seq[@]}" -f \$flank_max_edit_distance -e \$barcode_max_edit_distance
     }
 
     # Trims reverse primer with cutadapt
@@ -101,8 +95,8 @@ process PREPROCESS_FASTQ {
     decompress | chopper_cmd | save_intermediate "${sample}_intermediate_qfilter.fastq.gz" > ${sample}_chopper_out.fastq
 
     # Extract chemistry specfic parameters from config files
-    IFS=',' read -r _ left_flank barcode umi right_flank < <(awk -F',' -v chem=$meta.chemistry '\$1 == chem' $flank_seq_config)
-    IFS=',' read -r _ fwd_primer_f fwd_primer_r rev_primer_f rev_primer_r TSO_f TSO_r < <(awk -F',' -v chem=$meta.chemistry '\$1 == chem' $adapter_seq_config)
+    IFS=',' read -r _ left_flank barcode umi right_flank flank_max_edit_distance barcode_max_edit_distance < <(awk -F',' -v chem=$meta.chemistry '\$1 == chem' $flexiplex_config)
+    IFS=',' read -r _ fwd_primer_f fwd_primer_r rev_primer_f rev_primer_r TSO_f TSO_r < <(awk -F',' -v chem=$meta.chemistry '\$1 == chem' $cutadapt_config)
     # Store flexiplex search pattern as an array so the '?' wildcards are not expanded as shell globs
     flank_seq=(-x "\$left_flank" -b "\$barcode" -u "\$umi" -x "\$right_flank")