A beginner-friendly bioinformatics web application built with Python, Biopython, and Streamlit that analyzes DNA sequences and performs common molecular biology operations.
The DNA Sequence Analyzer allows users to manually enter DNA sequences or upload FASTA files for analysis.
The application validates DNA sequences and performs several bioinformatics analyses including GC content calculation, nucleotide counting, reverse complement generation, transcription, and protein translation.
This project was developed as part of my Bioinformatics and Python learning journey.
- ✅ Manual DNA sequence input
- ✅ FASTA file upload
- ✅ DNA sequence validation
- ✅ DNA length calculation
- ✅ GC content calculation
- ✅ Nucleotide count (A, T, G, C)
- ✅ Reverse complement generation
- ✅ DNA → RNA transcription
- ✅ RNA → Protein translation
- ✅ Download analysis report
- ✅ Clean Streamlit web interface
- Python 3
- Biopython
- Streamlit
DNA_Sequence_Analyzer/
│
├── app.py
├── dna_analyzer.py
├── sample.fasta
├── requirements.txt
├── README.md
├── LICENSE
├── .gitignore
└── screenshots/
├── home.png
├── manual_analysis.png
└── fasta_analysis.png
Clone the repository
git clone https://github.com/harminderkaur1329/DNA_Sequence_Analyzer.gitMove into the project folder
cd DNA_Sequence_AnalyzerInstall the required libraries
pip install -r requirements.txtstreamlit run app.pyThe application will automatically open in your web browser.
Example
>Sequence_1
ATGCGATCGATCGATCGATCGATCGATCG
>Sequence_2
ATTTGGGGCCCCAAAATTTGGGCCC
The application generates:
- DNA Length
- GC Content
- Nucleotide Counts
- Reverse Complement
- RNA Sequence
- Protein Sequence
- Downloadable Analysis Report
During this project I learned:
- Python programming
- Functions
- Biopython
- Streamlit
- FASTA file parsing
- DNA sequence validation
- File handling
- Building bioinformatics tools
- GC Content visualization
- Nucleotide frequency charts
- DNA motif search
- Restriction enzyme analysis
- DNA molecular weight calculation
- Amino acid composition analysis
Harminder Kaur
B.Tech Biotechnology
Aspiring Bioinformatics & AI Researcher
If you found this project helpful, consider giving it a ⭐ on GitHub.