Skip to content

Latest commit

 

History

34 Commits

Folders and files

NameName
Last commit message
Last commit date
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

Object Oriented Programming

OOP based projects covering Encapsulation, Inheritance, Polymorphism and Abstraction

Phase 1: Build a simple calculator class containing add, subtract, multiply, divide.
Phase 2: Expand by creating:
Divisible by method that returns true or false dependent on the outcome
Work out and return the area of a triangle
inch to cm converter
NOTE -> Must be in class and method format
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of a length 21 DNA string (whose alphabet contains the symbols 'A', 'C', 'G', and 'T') is "ATGCTTCAGAAAGGTCTTACG."
Given: A DNA string s of length at most 1000 nt.
Return: Four integers (separated by spaces) counting the respective number of times that the symbols 'A', 'C', 'G', and 'T' occur in s.
Sample Dataset:
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output:

20 12 17 21

NOTE -> Must be in class and method format

Project 3: Fizzbuzz 💡

Write a program that prints the numbers from 1 to 100. But for multiples of three print “Fizz” instead of the number and for multiples of five print “Buzz”. For numbers which are multiples of both three and five print “FizzBuzz”."

NOTE -> Must be in class and method format

Project 4: Scrabble 📚

Base Scrabble word calculator instructions
Given the below scoring create a Scrabble word calculator that will provide the correct scores dependent on the string provided.

Letter                             Value
A, E, I, O, U, L, N, R, S, T       1
D, G                               2
B, C, M, P                         3
F, H, V, W, Y                      4
K                                  5
J, X                               8
Q, Z                               10

Project criteria:

Student_data_inheritance
Student_data_encapsulation
Student_data_polymorphism
Student_data_abstraction

The 4 pillars of OOP

Inheritance

  • Inheritance is a way of creating a new class for using details of an existing class without modifying it. The newly formed class is a derived class (or child class). Similarly, the existing class is a base class(or parent class).

Using Inheritance in Python

# parent class
class Animal:
    def __init__(self, eat, walk, hungry=True, mood): # Setting default value of hunger to True
        self.eat = eat
        self.walk = walk
        self.hungry = hungry
        self.mood = mood

# child class
class Bird(Animal):
    # using super(), (temporary object of the superclass) allows us to access methods of the base class (parent class)
    def __init__(self):
        super().__init__()
        print("I am a bird")

    def tweet(self):
        print("tweet tweet")

    def fly(self):
        print("I am a free bird")

pippa = Bird()
pippa.tweet()

In the above program, we created two classes i.e. Animal (parent class) and Penguin (child class). The child class inherits the functions of parent class.

The child class modified the behaviour of the parent class. We also extended the functions of the parent class, by creating new methods like tweet() and fly().

We used the super() function inside the __init__() method. This allows us to run the __init__() method of the parent class inside the child class.


Encapsulation

  • Concept of encapsulation is to keep together the implementation (code) and the data it manipulates (variables).
  • Python does not have the private keyword, unlike some other object oriented languages.
  • In python, we can restrict access to methods and variables. This prevents data from being modified (encapsulation).
  • In python, we denote private attributes using underscore _ or dunder (double underscore) __ as the prefix.
class Robot(object):
    def __init__(self):
        self.a = 123
        self.b = 123
        self.__c = 123

obj = Robot()
print(obj.a)
print(obj._b)
print(obj.__c)

Outcome:

123
123
Traceback (most recent call last):
  File "test.py", line 10, in <module>
    print(obj.__c)
AttributeError: 'Robot' object has no attribute '__c' 

_ Single underscore denotes private variable. It should not be accessed directly.

__ Dunder or double underscore also denotes private variable.


Polymorphism

  • Poly means many
  • Morph means change
  • Polymorphism refers to the ability of an object taking many forms.
  • Python being an OOP supports Polymorphism through Method overriding and operator overloading.
  • Polymorphism can be achieved through inheritance - Method overriding
  • Method overriding provides ability to change the implementation of a method in a child class which is already defined in one of its super class or parent class.
  • If there is a method in a super class the method having the same name number of arguments in a child class is said to be overriding the parent class method.
  • We can use the concept of polymorphism while creating class methods as Python allows different classes to have methods with the same name.
  • We can then later generalise calling these methods by disregarding the object we are working with.
## Example of class polymorphism and inheritance 
from math import pi

class Shape: 
    def __init__(self, name):
        self.name = name

    def area(self):
        pass
    
    def fact(self):
        return "I am a two-dimensional shape."

    def __str__(self):
        return self.name

class Square(Shape):
    def __init__(self, length):
        super().__init__("Square")
        self.length = length
    
    def area(self):
        return self.length**2

    def fact(self):
        return "Squares have each angle equal to 90 degrees."

class Circle(Shape):
    def __init__(self, radius):
        super().init__("Circle")
        self.radius = radius

    def area(self):
        return pi*self.radius**2

a = Square(4)
b = Circle(7)
print(b)
print(b.fact())
print(a.fact())
print(b.area())

Output

Circle
I am a two-dimenional shape.
Squares have each angle equal to 90 degrees.
153.93804002589985

Methods such as __str__(), which have not been overridden in the child classes, are used from the parent class.

The fact() method for object a(Square class) is overridden. However, fact() method for object b has not been overridden. It is inheriting from the Parent Shape class.


Abstraction

  • Abstraction focuses on hiding the internal implementations of a process or method from the user. In this way, the user knows what he is doing but not how the work is being done.
  • Using a car as an analogy. We drive without knowing what is going on underneath. We use the breaks to stop the car but we don't know how the breaks work.
  • Another example is a TV set. We watch films without knowing the inner details of how TV works.
  • In Python, abstraction is achieved by using abstract classes and interfaces.

Key Points to Remember:

  • OOP makes the program easy to understand as well as efficient
  • The class is shareable, therefore the code can be reused.
  • Data is safe and secure with data abstraction.
  • Polymorphism allows the same interface for different objects (implement the same functionality), so programmers can write efficient code.
  • Encapsulation: only exposes selected information to the outside world.

Releases

Packages

Contributors

Languages